Interpretation and Guide
| Column | Description |
|---|---|
| Gene | The target gene (e.g., ATM, involved in DNA repair). |
| Rank | Scoring rank of the gRNA based on efficiency and specificity. |
| Target Sequence | The gRNA sequence designed to bind to the DNA target site. |
| Genomic Location | The reference location (e.g., seq:81) in a genome or contig. |
| Strand | Indicates whether the gRNA targets the forward (+) or reverse (-) strand. |
| GC Content | Percentage of G and C bases; affects stability and melting temperature. |
| Self-Comp | Self-complementarity score; high values may cause hairpin formation. |
| MM0–MM3 | Count of potential off-targets with 0–3 mismatches. |
| Efficiency | Predicted cleavage efficiency; higher is typically better. |
| Exon | Exon(s) targeted by the gRNA — useful for knockouts or edits. |
| Off-Target Loc | Predicted off-target locations in the genome. |
| Action | Link to view or design validation primers. |
- CRISPR Gene Editing: Select gRNAs with high precision and low off-target effects.
- Primer Design: Generate primers for validation, screening, and amplification.
- Functional Genomics: Disrupt specific exons to study gene function.
- Off-Target Analysis: Identify and validate unintended Cas9 cuts.
- Optimization: Balance efficiency and specificity for best editing outcomes.
| Field | Value | Interpretation |
|---|---|---|
| Gene | ATM | Targets the ATM gene, involved in DNA repair. |
| Target Sequence | CAAAGTGATATCAACCGGGCGGG | 23-nt guide RNA; guides Cas9 to specific DNA site. |
| Genomic Location | seq:81 | Position in genome reference . |
| Strand | - | Targets the reverse strand of DNA. |
| GC Content | 50.00% | Balanced GC content — optimal for stability and binding. |
| Self-Comp | 1 | Low hairpin potential — favorable design. |
| MM0 | 1 | Perfect match at only one site — desired on-target. |
| MM1/MM2/MM3 | 1/0/0 | One off-target with 1 mismatch, none with 2 or 3 mismatches — highly specific. |
| Efficiency | 68.20 | High predicted cleavage activity. |
| Exon | 4:exon:TSLP | Targets coding exon 4 — ideal for knockout studies. |
| Off-Target Location | chr11:108223147 | Only predicted off-target, on chromosome 11, with 1 mismatch. |
Developed by Sowmiya A
Department of Biotechnology,
Vivekanandha College of Arts and Sciences for Women (Autonomous)
Tiruchengode, Namakkal, Tamil Nadu, India.
Under the Supervision of Dr. Gnanendra Shanmugam
Department of Biotechnology,
Vivekanandha College of Arts and Sciences for Women (Autonomous)
Tiruchengode, Namakkal, Tamil Nadu, India.